Transcript: Human XM_006717542.3

PREDICTED: Homo sapiens USP6 N-terminal like (USP6NL), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
USP6NL (9712)
Length:
4674
CDS:
173..2743

Additional Resources:

NCBI RefSeq record:
XM_006717542.3
NBCI Gene record:
USP6NL (9712)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006717542.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253832 ACATGGTCAGAAGTTAGTTAT pLKO_005 2459 CDS 100% 13.200 18.480 N USP6NL n/a
2 TRCN0000253835 ATGCTAGCCGTGGCAATTTAC pLKO_005 2520 CDS 100% 13.200 18.480 N USP6NL n/a
3 TRCN0000253833 GTAGATAGTCCCGTGAGATAT pLKO_005 2600 CDS 100% 13.200 18.480 N USP6NL n/a
4 TRCN0000253834 GACAGTTCCAGGCAATATAAT pLKO_005 1631 CDS 100% 15.000 10.500 N USP6NL n/a
5 TRCN0000253836 AGAGTATGACTTCGTGTTTAA pLKO_005 4024 3UTR 100% 13.200 9.240 N USP6NL n/a
6 TRCN0000086812 CGAGCTGAAATAGTTGCTAAA pLKO.1 299 CDS 100% 10.800 7.560 N Usp6nl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006717542.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02231 pDONR223 100% 96.6% 96.4% None 1_79del;81A>T;84_88delAAAAG n/a
2 ccsbBroad304_02231 pLX_304 0% 96.6% 96.4% V5 1_79del;81A>T;84_88delAAAAG n/a
3 TRCN0000478778 TGACTCAGCAATGTGTACGTTCGA pLX_317 14.8% 96.6% 96.4% V5 1_79del;81A>T;84_88delAAAAG n/a
Download CSV