Transcript: Human XM_006717659.3

PREDICTED: Homo sapiens PWWP domain containing 2B (PWWP2B), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PWWP2B (170394)
Length:
1907
CDS:
32..1804

Additional Resources:

NCBI RefSeq record:
XM_006717659.3
NBCI Gene record:
PWWP2B (170394)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006717659.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000156752 GCTATAACCGAGGCTGCAAAT pLKO.1 1727 CDS 100% 10.800 15.120 N PWWP2B n/a
2 TRCN0000439619 GAAGCGAAGGTCTCGTGGTTT pLKO_005 1604 CDS 100% 4.950 6.930 N PWWP2B n/a
3 TRCN0000412921 AGTTTGAAACGTAACTGGTTC pLKO_005 1791 CDS 100% 4.050 5.670 N PWWP2B n/a
4 TRCN0000156843 GCGTGTTCTTGACATCAGTCT pLKO.1 1549 CDS 100% 2.640 3.696 N PWWP2B n/a
5 TRCN0000154934 GTATCGGAAAGCTATAACCGA pLKO.1 1717 CDS 100% 0.750 1.050 N PWWP2B n/a
6 TRCN0000418051 CGGAAATCAGGGAGCTCTTAA pLKO_005 1767 CDS 100% 13.200 9.240 N PWWP2B n/a
7 TRCN0000435888 ACTGAGATTTAATCGTAAGAA pLKO_005 1687 CDS 100% 5.625 3.938 N PWWP2B n/a
8 TRCN0000156497 CGGACTTGTCTTCTGGAAGTT pLKO.1 1164 CDS 100% 4.950 3.465 N PWWP2B n/a
9 TRCN0000156873 GTGAGGACGATGACTTCAAGA pLKO.1 1188 CDS 100% 4.950 3.465 N PWWP2B n/a
10 TRCN0000156968 GACGATGACTTCAAGAGCTGT pLKO.1 1193 CDS 100% 2.640 1.848 N PWWP2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006717659.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13359 pDONR223 100% 86.8% 86.6% None 1_231del;265C>T;292C>G n/a
2 ccsbBroad304_13359 pLX_304 0% 86.8% 86.6% V5 1_231del;265C>T;292C>G n/a
3 TRCN0000474717 TGTGACCTCCGTAGTTACCAAATG pLX_317 28.6% 86.8% 86.6% V5 1_231del;265C>T;292C>G n/a
Download CSV