Transcript: Human XM_006717680.3

PREDICTED: Homo sapiens DNA replication helicase/nuclease 2 (DNA2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DNA2 (1763)
Length:
4647
CDS:
400..3672

Additional Resources:

NCBI RefSeq record:
XM_006717680.3
NBCI Gene record:
DNA2 (1763)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006717680.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000009830 CAGTTAACCGTGCAGTACAGA pLKO.1 2953 CDS 100% 3.000 4.200 N DNA2 n/a
2 TRCN0000039919 CCCTCTGATATTGGTATTATT pLKO.1 3289 CDS 100% 15.000 12.000 N DNA2 n/a
3 TRCN0000039922 CGAAGTTAATACAGTAGACAA pLKO.1 3372 CDS 100% 4.950 3.960 N DNA2 n/a
4 TRCN0000424119 AGTTTGTGATGGGCAATATTT pLKO_005 1959 CDS 100% 15.000 10.500 N DNA2 n/a
5 TRCN0000432076 ACCTGGTGTTGGCAGTCAATA pLKO_005 629 CDS 100% 13.200 9.240 N DNA2 n/a
6 TRCN0000039918 CCAGCTTTGAAGATGGATTAA pLKO.1 3876 3UTR 100% 13.200 9.240 N DNA2 n/a
7 TRCN0000039921 GCCAGGAGATATCATTCATTT pLKO.1 765 CDS 100% 13.200 9.240 N DNA2 n/a
8 TRCN0000039920 CCTCAGTTTATATCCTACCTT pLKO.1 2290 CDS 100% 3.000 2.100 N DNA2 n/a
9 TRCN0000009829 CAAGAGAGAAGAGCTGATCCA pLKO.1 1453 CDS 100% 2.640 1.584 N DNA2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006717680.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10783 pDONR223 100% 63% 61% None 1_90del;2077_2191del;2267_3270del n/a
2 ccsbBroad304_10783 pLX_304 0% 63% 61% V5 1_90del;2077_2191del;2267_3270del n/a
3 TRCN0000470405 GCGACCGCACGGGATGCCATATGG pLX_317 16.4% 63% 61% V5 1_90del;2077_2191del;2267_3270del n/a
Download CSV