Transcript: Human XM_006717820.4

PREDICTED: Homo sapiens coiled-coil domain containing 172 (CCDC172), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CCDC172 (374355)
Length:
1982
CDS:
583..1323

Additional Resources:

NCBI RefSeq record:
XM_006717820.4
NBCI Gene record:
CCDC172 (374355)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006717820.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000140513 GCCGTTTGATGCGAGAAGTAA pLKO.1 644 CDS 100% 5.625 7.875 N CCDC172 n/a
2 TRCN0000145426 GAAATAACCAGATGTCGTGAA pLKO.1 670 CDS 100% 4.050 5.670 N CCDC172 n/a
3 TRCN0000139993 GCGAGAAGTAAGGTCGGAAAT pLKO.1 654 CDS 100% 10.800 8.640 N CCDC172 n/a
4 TRCN0000143452 GAGTTGACATTGGCACAGAAA pLKO.1 1282 CDS 100% 4.950 3.960 N CCDC172 n/a
5 TRCN0000143922 CGAGAAGTAAGGTCGGAAATA pLKO.1 655 CDS 100% 13.200 9.240 N CCDC172 n/a
6 TRCN0000121925 CTTCAAACCTTTGAGGCTATA pLKO.1 817 CDS 100% 10.800 7.560 N CCDC172 n/a
7 TRCN0000145075 CACAGAAAGATCTTCAGGAAA pLKO.1 1295 CDS 100% 4.950 3.465 N CCDC172 n/a
8 TRCN0000121570 CCAAATATCTAGAGGCAGAAA pLKO.1 1133 CDS 100% 4.950 3.465 N CCDC172 n/a
9 TRCN0000121954 CCATAGGAATATGCTTCTTCA pLKO.1 801 CDS 100% 4.950 3.465 N CCDC172 n/a
10 TRCN0000144813 GAAGATGACATGGAAAGTGTT pLKO.1 1228 CDS 100% 4.950 3.465 N CCDC172 n/a
11 TRCN0000139834 CATCATCTTCACCGAGCATCA pLKO.1 609 CDS 100% 4.050 2.835 N CCDC172 n/a
12 TRCN0000145103 GAAAGATCTTCAGGAAAGCAA pLKO.1 1299 CDS 100% 3.000 2.100 N CCDC172 n/a
13 TRCN0000143802 GAGGAGCTGAATGAAGAGAAA pLKO.1 709 CDS 100% 4.950 2.970 N CCDC172 n/a
14 TRCN0000145172 GAAACAAATGATAGAGGAGGA pLKO.1 840 CDS 100% 2.160 1.080 Y CCDC172 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006717820.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05532 pDONR223 100% 95.3% 95.3% None 163_164ins36 n/a
2 ccsbBroad304_05532 pLX_304 0% 95.3% 95.3% V5 163_164ins36 n/a
3 TRCN0000468436 TTCCGCAGCAACAAATAGGTTTTG pLX_317 63.9% 95.3% 95.3% V5 163_164ins36 n/a
Download CSV