Transcript: Human XM_006718178.2

PREDICTED: Homo sapiens dickkopf WNT signaling pathway inhibitor 3 (DKK3), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DKK3 (27122)
Length:
2463
CDS:
53..1105

Additional Resources:

NCBI RefSeq record:
XM_006718178.2
NBCI Gene record:
DKK3 (27122)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006718178.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000033398 GACACGAAGGTTGGAAATAAT pLKO.1 353 CDS 100% 15.000 10.500 N DKK3 n/a
2 TRCN0000033396 CCCAGCATGTACTGCCAGTTT pLKO.1 515 CDS 100% 4.950 3.465 N DKK3 n/a
3 TRCN0000033395 GCAAACTTACCTCCCAGCTAT pLKO.1 314 CDS 100% 4.950 3.465 N DKK3 n/a
4 TRCN0000033394 GCACCGAGAAATTCACAAGAT pLKO.1 385 CDS 100% 4.950 3.465 N DKK3 n/a
5 TRCN0000033397 GCTGCTAAAGCATCATCAGAA pLKO.1 284 CDS 100% 4.950 3.465 N DKK3 n/a
6 TRCN0000071752 TCTGTGACAACCAGAGGGATT pLKO.1 672 CDS 100% 4.050 2.430 N Dkk3 n/a
7 TRCN0000352104 TCTGTGACAACCAGAGGGATT pLKO_005 672 CDS 100% 4.050 2.430 N Dkk3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006718178.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08057 pDONR223 100% 99.9% 99.7% None 1003A>G n/a
2 ccsbBroad304_08057 pLX_304 0% 99.9% 99.7% V5 1003A>G n/a
3 TRCN0000472220 GCGCGAATCTCTACGAAAAGAAAT pLX_317 26.9% 99.9% 99.7% V5 1003A>G n/a
Download CSV