Transcript: Human XM_006718941.3

PREDICTED: Homo sapiens CD3g molecule (CD3G), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CD3G (917)
Length:
1065
CDS:
72..620

Additional Resources:

NCBI RefSeq record:
XM_006718941.3
NBCI Gene record:
CD3G (917)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006718941.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000057223 CGGCTTCCTAACTGAAGATAA pLKO.1 257 CDS 100% 13.200 18.480 N CD3G n/a
2 TRCN0000424206 TAATTCACATGGCTCAAATAT pLKO_005 939 3UTR 100% 15.000 10.500 N CD3G n/a
3 TRCN0000057225 CAGAACTGCATTGAACTAAAT pLKO.1 384 CDS 100% 13.200 9.240 N CD3G n/a
4 TRCN0000435515 GAAAGGCCATCAGAGCAAATT pLKO_005 756 3UTR 100% 13.200 9.240 N CD3G n/a
5 TRCN0000413138 TGGCTTTCTCTTTGCTGAAAT pLKO_005 419 CDS 100% 13.200 9.240 N CD3G n/a
6 TRCN0000422074 ACCACTTGGTTAAGGTGTATG pLKO_005 154 CDS 100% 10.800 7.560 N CD3G n/a
7 TRCN0000057224 CTGGCTATCATTCTTCTTCAA pLKO.1 105 CDS 100% 4.950 3.465 N CD3G n/a
8 TRCN0000057227 GTATTACAGAATGTGTCAGAA pLKO.1 368 CDS 100% 4.950 3.465 N CD3G n/a
9 TRCN0000057226 CCACCTTCAAGGAAACCAGTT pLKO.1 587 CDS 100% 4.050 2.835 N CD3G n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006718941.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00245 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00245 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000471686 TGTTGCATCCACGTCATTGGGAAG pLX_317 92.9% 100% 100% V5 n/a
Download CSV