Transcript: Human XM_006719018.2

PREDICTED: Homo sapiens adiponectin receptor 2 (ADIPOR2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ADIPOR2 (79602)
Length:
4079
CDS:
317..1477

Additional Resources:

NCBI RefSeq record:
XM_006719018.2
NBCI Gene record:
ADIPOR2 (79602)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006719018.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000060572 GCTCTTCTCTAAACTGGATTA pLKO.1 955 CDS 100% 10.800 7.560 N ADIPOR2 n/a
2 TRCN0000299673 GCTCTTCTCTAAACTGGATTA pLKO_005 955 CDS 100% 10.800 7.560 N ADIPOR2 n/a
3 TRCN0000060569 CCTTGCTTCATCTACTTGATT pLKO.1 1049 CDS 100% 5.625 3.938 N ADIPOR2 n/a
4 TRCN0000299649 CCTTGCTTCATCTACTTGATT pLKO_005 1049 CDS 100% 5.625 3.938 N ADIPOR2 n/a
5 TRCN0000060568 GCCAGATATAAGGCTCAGAAA pLKO.1 364 CDS 100% 4.950 3.465 N ADIPOR2 n/a
6 TRCN0000299672 GCCAGATATAAGGCTCAGAAA pLKO_005 364 CDS 100% 4.950 3.465 N ADIPOR2 n/a
7 TRCN0000060570 GCCTGAGTGGAATCATTCCTA pLKO.1 1173 CDS 100% 3.000 2.100 N ADIPOR2 n/a
8 TRCN0000299674 GCCTGAGTGGAATCATTCCTA pLKO_005 1173 CDS 100% 3.000 2.100 N ADIPOR2 n/a
9 TRCN0000277172 GGACTCCAGAGCCAGATATAC pLKO_005 354 CDS 100% 13.200 9.240 N Adipor2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006719018.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04087 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04087 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000466625 ACGAGCATACTATGGCCATGTAGA pLX_317 30% 100% 100% V5 n/a
Download CSV