Transcript: Human XM_006719097.3

PREDICTED: Homo sapiens family with sequence similarity 90 member A1 (FAM90A1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FAM90A1 (55138)
Length:
2418
CDS:
407..1858

Additional Resources:

NCBI RefSeq record:
XM_006719097.3
NBCI Gene record:
FAM90A1 (55138)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006719097.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434557 AGGGACTCTGCCACGTTGAAT pLKO_005 2026 3UTR 100% 5.625 3.938 N FAM90A1 n/a
2 TRCN0000149950 GCTCTCTAGACGACTGAATAA pLKO.1 2201 3UTR 100% 13.200 7.920 N FAM90A1 n/a
3 TRCN0000415885 CCCTGGTTCCACCGAACTTTG pLKO_005 663 CDS 100% 3.600 2.160 N FAM90A1 n/a
4 TRCN0000269244 ACTTCCGCTGGGACGTCAATA pLKO_005 2154 3UTR 100% 13.200 6.600 Y FAM90A7P n/a
5 TRCN0000129381 GAAGGCTCTCCTCCACATATT pLKO.1 805 CDS 100% 13.200 6.600 Y FAM90A1 n/a
6 TRCN0000417465 AGCCTCTCAGAGTGCTCTTTC pLKO_005 1632 CDS 100% 10.800 5.400 Y FAM90A1 n/a
7 TRCN0000421909 GATCGCTCAGCTACCGAAATG pLKO_005 962 CDS 100% 10.800 5.400 Y FAM90A1 n/a
8 TRCN0000269243 TGATCGCTCAGCTACCGAAAT pLKO_005 961 CDS 100% 10.800 5.400 Y FAM90A7P n/a
9 TRCN0000269246 CGGTCCACACAACCAGTAAGA pLKO_005 915 CDS 100% 4.950 2.475 Y FAM90A7P n/a
10 TRCN0000146372 CTCATTTCACTCTCCTGAGAA pLKO.1 1699 CDS 100% 4.950 2.475 Y FAM90A1 n/a
11 TRCN0000149663 GATCCACGGAATCTTCTGATT pLKO.1 867 CDS 100% 4.950 2.475 Y FAM90A1 n/a
12 TRCN0000269247 TCCTCAGAGGACAGCGATTCT pLKO_005 1826 CDS 100% 4.950 2.475 Y FAM90A7P n/a
13 TRCN0000150084 CGGAATCTTCTGATTATCTGA pLKO.1 873 CDS 100% 3.000 1.500 Y FAM90A1 n/a
14 TRCN0000129353 CCTCATTTCACTCTCCTGAGA pLKO.1 1698 CDS 100% 2.640 1.320 Y FAM90A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006719097.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08474 pDONR223 100% 90.6% 86.6% None (many diffs) n/a
2 ccsbBroad304_08474 pLX_304 0% 90.6% 86.6% V5 (many diffs) n/a
3 TRCN0000479550 ATCACGGATCGCGCTCTGGTGTGC pLX_317 24.5% 90.6% 86.6% V5 (many diffs) n/a
Download CSV