Transcript: Human XM_006719153.3

PREDICTED: Homo sapiens pyridine nucleotide-disulphide oxidoreductase domain 1 (PYROXD1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PYROXD1 (79912)
Length:
1068
CDS:
102..881

Additional Resources:

NCBI RefSeq record:
XM_006719153.3
NBCI Gene record:
PYROXD1 (79912)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006719153.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000064318 CCCAACATTAAGGTTATAGAA pLKO.1 333 CDS 100% 5.625 7.875 N PYROXD1 n/a
2 TRCN0000424713 GAAGTGATTTGGGCCATTAAA pLKO_005 609 CDS 100% 15.000 10.500 N PYROXD1 n/a
3 TRCN0000064319 CGGTGGTATTGCACTTGAGTT pLKO.1 566 CDS 100% 4.950 3.465 N PYROXD1 n/a
4 TRCN0000064320 CCAGATATACAACTGAAGGAA pLKO.1 733 CDS 100% 3.000 2.100 N PYROXD1 n/a
5 TRCN0000064322 GCTACTCACTTTCCATCGGAA pLKO.1 189 CDS 100% 2.640 1.848 N PYROXD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006719153.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04147 pDONR223 100% 51% 50.2% None (many diffs) n/a
2 ccsbBroad304_04147 pLX_304 0% 51% 50.2% V5 (many diffs) n/a
3 TRCN0000472946 CTCATCCCTGCACTGGGAGCTTCC pLX_317 26.3% 51% 50.2% V5 (many diffs) n/a
Download CSV