Transcript: Human XM_006719895.2

PREDICTED: Homo sapiens klotho (KL), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KL (9365)
Length:
4412
CDS:
354..2471

Additional Resources:

NCBI RefSeq record:
XM_006719895.2
NBCI Gene record:
KL (9365)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006719895.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419459 GGTTTGCCAAACCCGTATTTA pLKO_005 409 CDS 100% 15.000 21.000 N KL n/a
2 TRCN0000433013 TAATTGCAAGAGTTCGAATAG pLKO_005 2850 3UTR 100% 10.800 15.120 N KL n/a
3 TRCN0000161740 CGCTGAAACATGCTAGTGATA pLKO.1 3630 3UTR 100% 4.950 6.930 N KL n/a
4 TRCN0000158823 GTTGTTGACAACTACATTCAA pLKO.1 1011 CDS 100% 5.625 4.500 N KL n/a
5 TRCN0000158579 CAAGGCATCCATGAAACATTA pLKO.1 2243 CDS 100% 13.200 9.240 N KL n/a
6 TRCN0000159334 GCTGAACCAAAGAAACAATTT pLKO.1 1763 CDS 100% 13.200 9.240 N KL n/a
7 TRCN0000434788 TAAGCTCTCACTGGATCAATC pLKO_005 325 5UTR 100% 10.800 7.560 N KL n/a
8 TRCN0000161418 GCCTTGCACATAGGAAACTTT pLKO.1 3173 3UTR 100% 5.625 3.938 N KL n/a
9 TRCN0000160036 CTTCCTTATTTCACTGAAGAT pLKO.1 1788 CDS 100% 4.950 3.465 N KL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006719895.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488650 CATCGGACAGCATTTCGAGCAGGA pLX_317 12.9% 69.6% 69.5% V5 0_1ins921;2115_2116insG n/a
Download CSV