Transcript: Human XM_006719896.4

PREDICTED: Homo sapiens epithelial stromal interaction 1 (EPSTI1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EPSTI1 (94240)
Length:
1380
CDS:
107..1036

Additional Resources:

NCBI RefSeq record:
XM_006719896.4
NBCI Gene record:
EPSTI1 (94240)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006719896.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428040 CACCTTGATAGCACCAAATAT pLKO_005 307 CDS 100% 15.000 10.500 N EPSTI1 n/a
2 TRCN0000428667 CTCCAGCTGATGCAATCTAAA pLKO_005 479 CDS 100% 13.200 9.240 N EPSTI1 n/a
3 TRCN0000130236 CTGAAGAAGCTGAACTCCAAA pLKO.1 549 CDS 100% 4.950 3.465 N EPSTI1 n/a
4 TRCN0000130015 GAAACTGAAGTCAGACAGAAA pLKO.1 452 CDS 100% 4.950 3.465 N EPSTI1 n/a
5 TRCN0000128242 GAGTGAATTACTGGAACTGAA pLKO.1 880 CDS 100% 4.950 3.465 N EPSTI1 n/a
6 TRCN0000129815 CGGAGAAATGAGATACAAAGA pLKO.1 332 CDS 100% 4.950 2.970 N EPSTI1 n/a
7 TRCN0000131127 GAAGGAGCAGAACAGAGCTAA pLKO.1 388 CDS 100% 4.950 2.970 N EPSTI1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006719896.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04621 pDONR223 100% 70.2% 67.8% None (many diffs) n/a
2 ccsbBroad304_04621 pLX_304 0% 70.2% 67.8% V5 (many diffs) n/a
3 TRCN0000469999 GGTAGGTATCTCATTCTACCTTTT pLX_317 26.5% 70.2% 67.8% V5 (many diffs) n/a
Download CSV