Transcript: Human XM_006719986.2

PREDICTED: Homo sapiens transmembrane protein 255B (TMEM255B), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TMEM255B (348013)
Length:
2697
CDS:
90..803

Additional Resources:

NCBI RefSeq record:
XM_006719986.2
NBCI Gene record:
TMEM255B (348013)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006719986.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000436703 TGCTACGCACCCACCTACTTT pLKO_005 747 CDS 100% 5.625 7.875 N TMEM255B n/a
2 TRCN0000149337 GCATCAACTTGGTGGAGAATA pLKO.1 32 5UTR 100% 13.200 9.240 N TMEM255B n/a
3 TRCN0000432111 GTTACTGCTGTGACCTCTATG pLKO_005 301 CDS 100% 10.800 7.560 N TMEM255B n/a
4 TRCN0000183820 CTTTGGATCTTTCTTAGGAAT pLKO.1 6 5UTR 100% 4.950 3.465 N TMEM255B n/a
5 TRCN0000147598 GCTTTGGATCTTTCTTAGGAA pLKO.1 5 5UTR 100% 3.000 2.100 N TMEM255B n/a
6 TRCN0000196129 GTACGATGTCTACCAGACAGA pLKO.1 123 CDS 100% 2.640 1.848 N TMEM255B n/a
7 TRCN0000184148 CTACTATGAGTTCATCGGCGT pLKO.1 350 CDS 100% 0.540 0.378 N TMEM255B n/a
8 TRCN0000430535 TCAACTTGGTGGAGAATAGAA pLKO_005 35 5UTR 100% 5.625 3.375 N TMEM255B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006719986.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05512 pDONR223 100% 56.5% 58.5% None 0_1ins368;56_156del n/a
2 ccsbBroad304_05512 pLX_304 0% 56.5% 58.5% V5 0_1ins368;56_156del n/a
3 TRCN0000472329 TCTGAAATCTAACTATCACACCAC pLX_317 40.6% 56.5% 58.5% V5 0_1ins368;56_156del n/a
Download CSV