Transcript: Human XM_006720012.2

PREDICTED: Homo sapiens WD repeat and HMG-box DNA binding protein 1 (WDHD1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
WDHD1 (11169)
Length:
6013
CDS:
89..3472

Additional Resources:

NCBI RefSeq record:
XM_006720012.2
NBCI Gene record:
WDHD1 (11169)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006720012.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000005310 GCATCCTACTTGTGGTCGAAT pLKO.1 931 CDS 100% 4.950 6.930 N WDHD1 n/a
2 TRCN0000432252 GCTTCTCGCTCTCGGAAATTA pLKO_005 2486 CDS 100% 15.000 10.500 N WDHD1 n/a
3 TRCN0000425386 TTCAGCACGTTCAACTAATAT pLKO_005 2866 CDS 100% 15.000 10.500 N WDHD1 n/a
4 TRCN0000010933 CCCTGCTTCTTCGATTGTTTA pLKO.1 1740 CDS 100% 13.200 9.240 N WDHD1 n/a
5 TRCN0000427861 TAGCAGCCAAGGACGAGTAAA pLKO_005 2797 CDS 100% 13.200 9.240 N WDHD1 n/a
6 TRCN0000005312 CCTCAGAATGAGGATATTGAA pLKO.1 1676 CDS 100% 5.625 3.938 N WDHD1 n/a
7 TRCN0000005311 CCCATTATAAAGCCTCTGATT pLKO.1 2957 CDS 100% 4.950 3.465 N WDHD1 n/a
8 TRCN0000005309 CGAGTCTTTGGGAAACTCATT pLKO.1 3534 3UTR 100% 4.950 3.465 N WDHD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006720012.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.