Transcript: Human XM_006720435.3

PREDICTED: Homo sapiens chondroitin sulfate synthase 1 (CHSY1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CHSY1 (22856)
Length:
3828
CDS:
575..2167

Additional Resources:

NCBI RefSeq record:
XM_006720435.3
NBCI Gene record:
CHSY1 (22856)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006720435.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425320 GTCCGTATACAAGGATATATT pLKO_005 2246 3UTR 100% 15.000 21.000 N CHSY1 n/a
2 TRCN0000045464 CGACATTGTCATGCAGGTCAT pLKO.1 976 CDS 100% 4.050 3.240 N CHSY1 n/a
3 TRCN0000418335 ACATGCTGAGCCGCAAGATAT pLKO_005 711 CDS 100% 13.200 9.240 N CHSY1 n/a
4 TRCN0000431095 GATGAGAGATTACCGCATTAA pLKO_005 1516 CDS 100% 13.200 9.240 N CHSY1 n/a
5 TRCN0000428897 TCAGCGATGTCGAGCAAATAC pLKO_005 1681 CDS 100% 13.200 9.240 N CHSY1 n/a
6 TRCN0000045465 CCCAGTTTAACAATGAATCTT pLKO.1 1614 CDS 100% 5.625 3.938 N CHSY1 n/a
7 TRCN0000045466 CCAAGAGAATCAATCAGGAAT pLKO.1 1239 CDS 100% 4.950 3.465 N CHSY1 n/a
8 TRCN0000045463 CCTCGTGTTTACTACAGAATT pLKO.1 1657 CDS 100% 0.000 0.000 N CHSY1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006720435.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.