Transcript: Human XM_006720948.4

PREDICTED: Homo sapiens rogdi atypical leucine zipper (ROGDI), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ROGDI (79641)
Length:
1612
CDS:
505..1119

Additional Resources:

NCBI RefSeq record:
XM_006720948.4
NBCI Gene record:
ROGDI (79641)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006720948.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000077953 CCCACCTAACACATTTGCACT pLKO.1 1239 3UTR 100% 2.640 2.112 N ROGDI n/a
2 TRCN0000356592 CAACGCCAGGCTGCTATTTAT pLKO_005 1198 3UTR 100% 15.000 10.500 N ROGDI n/a
3 TRCN0000077956 CCATGTGAGCCAAGCCATTTA pLKO.1 588 CDS 100% 13.200 9.240 N ROGDI n/a
4 TRCN0000356651 TGATCACCATGGGAATCTTTG pLKO_005 1371 3UTR 100% 10.800 7.560 N ROGDI n/a
5 TRCN0000356654 CCAAGCCATTTACCTGCTTAC pLKO_005 597 CDS 100% 6.000 4.200 N ROGDI n/a
6 TRCN0000356591 AGGACAAGATCTCCGTGTTCT pLKO_005 1070 CDS 100% 4.950 3.465 N ROGDI n/a
7 TRCN0000077954 GCTGGTCAACGTCTACATCAA pLKO.1 798 CDS 100% 4.950 3.465 N ROGDI n/a
8 TRCN0000077957 GCAGCCCAACTCCACCAAGAA pLKO.1 861 CDS 100% 1.650 1.155 N ROGDI n/a
9 TRCN0000077955 CAACGTCTACATCAACCTCAA pLKO.1 804 CDS 100% 4.050 2.430 N ROGDI n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006720948.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08941 pDONR223 100% 66.8% 66.6% None 0_1ins270;144G>A;426_446del n/a
2 ccsbBroad304_08941 pLX_304 0% 66.8% 66.6% V5 0_1ins270;144G>A;426_446del n/a
3 TRCN0000478692 CTCGTTACAATCCGGCTCGAGTAC pLX_317 42.6% 66.8% 66.6% V5 0_1ins270;144G>A;426_446del n/a
Download CSV