Transcript: Human XM_006721023.4

PREDICTED: Homo sapiens NSE1 homolog, SMC5-SMC6 complex component (NSMCE1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NSMCE1 (197370)
Length:
1247
CDS:
284..1084

Additional Resources:

NCBI RefSeq record:
XM_006721023.4
NBCI Gene record:
NSMCE1 (197370)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006721023.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000073232 TGCGTCTTCCACAAACATATT pLKO.1 652 CDS 100% 13.200 18.480 N NSMCE1 n/a
2 TRCN0000073229 CCCATTTATGCGTTGGTGAAT pLKO.1 527 CDS 100% 4.950 6.930 N NSMCE1 n/a
3 TRCN0000437991 GCTAGAGGAATGGGACGTGAA pLKO_005 364 CDS 100% 4.050 5.670 N NSMCE1 n/a
4 TRCN0000446479 ACAAGGTCCATGACCGCAATG pLKO_005 405 CDS 100% 6.000 7.800 N NSMCE1 n/a
5 TRCN0000073228 GCCAAGTACTTCCAGTCGAAT pLKO.1 932 CDS 100% 4.950 3.960 N NSMCE1 n/a
6 TRCN0000073231 CGTAGATAAGTTGGAGGACTT pLKO.1 430 CDS 100% 4.050 3.240 N NSMCE1 n/a
7 TRCN0000422883 AGTCCTTGTATATTGAGATAA pLKO_005 477 CDS 100% 13.200 9.240 N NSMCE1 n/a
8 TRCN0000433508 GGGAGTCTGGTGTCTTGAAAT pLKO_005 1029 CDS 100% 13.200 9.240 N NSMCE1 n/a
9 TRCN0000073230 TGGTGAATCTTGCTACAACTT pLKO.1 540 CDS 100% 4.950 3.465 N NSMCE1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006721023.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13377 pDONR223 100% 96.1% 95.8% None 1_30del;140A>G n/a
2 ccsbBroad304_13377 pLX_304 0% 96.1% 95.8% V5 1_30del;140A>G n/a
3 TRCN0000469879 GTGTATAACTTGATTCATGGCTCC pLX_317 55.9% 96.1% 95.8% V5 1_30del;140A>G n/a
Download CSV