Transcript: Human XM_006721171.4

PREDICTED: Homo sapiens zinc finger protein 423 (ZNF423), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF423 (23090)
Length:
9233
CDS:
1590..5489

Additional Resources:

NCBI RefSeq record:
XM_006721171.4
NBCI Gene record:
ZNF423 (23090)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006721171.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000274304 ATTGTTCCAAGCGGGACTTTA pLKO_005 2872 CDS 100% 13.200 18.480 N ZNF423 n/a
2 TRCN0000274362 GGAGTATCCTTGCAATCAATG pLKO_005 3524 CDS 100% 10.800 15.120 N ZNF423 n/a
3 TRCN0000018176 TGACGGTAATAATGCTTTCTT pLKO.1 3167 CDS 100% 5.625 7.875 N ZNF423 n/a
4 TRCN0000018177 GTCAAGTTTGAGAGTGCCGAA pLKO.1 5013 CDS 100% 2.160 3.024 N ZNF423 n/a
5 TRCN0000274366 AGTCCTTCATGGAGGTCTATT pLKO_005 3304 CDS 100% 13.200 9.240 N ZNF423 n/a
6 TRCN0000274364 GAACATTACATCCAATCAAAG pLKO_005 5555 3UTR 100% 10.800 7.560 N ZNF423 n/a
7 TRCN0000018175 CCTGAAACTCACCAAGCACAT pLKO.1 3365 CDS 100% 4.050 2.835 N ZNF423 n/a
8 TRCN0000274363 CCTGAAACTCACCAAGCACAT pLKO_005 3365 CDS 100% 4.050 2.835 N ZNF423 n/a
9 TRCN0000018173 GCAACGTTTGTTCACGGACTT pLKO.1 4429 CDS 100% 4.050 2.835 N ZNF423 n/a
10 TRCN0000018174 CCACATGATTGAGGAAGGCAT pLKO.1 5201 CDS 100% 2.640 1.848 N ZNF423 n/a
11 TRCN0000084711 CGACCTCAAGTTCTCCAACTT pLKO.1 3545 CDS 100% 0.495 0.297 N Zfp423 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006721171.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07835 pDONR223 100% 98.7% 98.4% None (many diffs) n/a
2 ccsbBroad304_07835 pLX_304 0% 98.7% 98.4% V5 (many diffs) n/a
3 TRCN0000473266 GCCTACTCAAGCGCAAGCGAATGC pLX_317 13% 98.7% 98.4% V5 (many diffs) n/a
Download CSV