Transcript: Human XM_006721447.3

PREDICTED: Homo sapiens cytochrome b5 domain containing 2 (CYB5D2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CYB5D2 (124936)
Length:
2265
CDS:
898..1650

Additional Resources:

NCBI RefSeq record:
XM_006721447.3
NBCI Gene record:
CYB5D2 (124936)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006721447.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000154267 CCAATACAGTACGAGGCAATA pLKO.1 1998 3UTR 100% 10.800 15.120 N CYB5D2 n/a
2 TRCN0000156943 GACAACCCTCCACACAGAAAT pLKO.1 1549 CDS 100% 13.200 9.240 N CYB5D2 n/a
3 TRCN0000152178 CACTTCACAATTGGCTTTCAT pLKO.1 1199 CDS 100% 5.625 3.938 N CYB5D2 n/a
4 TRCN0000156327 CTTGGAGGCCAACAAACTACA pLKO.1 1329 CDS 100% 4.950 3.465 N CYB5D2 n/a
5 TRCN0000156874 GCTGTATAAGCCAGGTGCTAA pLKO.1 1473 CDS 100% 4.950 3.465 N CYB5D2 n/a
6 TRCN0000156687 GCCAATACAGTACGAGGCAAT pLKO.1 1997 3UTR 100% 4.050 2.835 N CYB5D2 n/a
7 TRCN0000153552 CTGACACTTCACAATTGGCTT pLKO.1 1195 CDS 100% 2.640 1.848 N CYB5D2 n/a
8 TRCN0000156810 GCCAACAAACTACAGCTGCAA pLKO.1 1336 CDS 100% 2.640 1.848 N CYB5D2 n/a
9 TRCN0000153364 GAGATGCTGACACTTCACAAT pLKO.1 1189 CDS 100% 4.950 2.970 N CYB5D2 n/a
10 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 81 5UTR 100% 5.625 2.813 Y KLHL30 n/a
11 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 81 5UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006721447.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04793 pDONR223 100% 77% 69.7% None (many diffs) n/a
2 ccsbBroad304_04793 pLX_304 0% 77% 69.7% V5 (many diffs) n/a
3 TRCN0000465792 GTGGAGCCAGTCCTACCCGTGGCC pLX_317 48.2% 77% 69.7% V5 (many diffs) n/a
Download CSV