Transcript: Human XM_006721564.2

PREDICTED: Homo sapiens zinc finger and BTB domain containing 4 (ZBTB4), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZBTB4 (57659)
Length:
5773
CDS:
158..3199

Additional Resources:

NCBI RefSeq record:
XM_006721564.2
NBCI Gene record:
ZBTB4 (57659)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006721564.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000015784 CGCTATTGTGAGAAAGTGTTT pLKO.1 1175 CDS 100% 4.950 6.930 N ZBTB4 n/a
2 TRCN0000297846 CGCTATTGTGAGAAAGTGTTT pLKO_005 1175 CDS 100% 4.950 6.930 N ZBTB4 n/a
3 TRCN0000015785 GTCTTTGGCTACGCAGTGAAT pLKO.1 3056 CDS 100% 4.950 6.930 N ZBTB4 n/a
4 TRCN0000280405 GTCTTTGGCTACGCAGTGAAT pLKO_005 3056 CDS 100% 4.950 6.930 N ZBTB4 n/a
5 TRCN0000015787 CCAACTCTTCCTCCACCAATT pLKO.1 3116 CDS 100% 10.800 7.560 N ZBTB4 n/a
6 TRCN0000280406 TCTCCTGGGAAGGGATCTTTC pLKO_005 3372 3UTR 100% 10.800 7.560 N ZBTB4 n/a
7 TRCN0000015786 GCCCAAGCTCAATACACTCAA pLKO.1 1375 CDS 100% 4.950 3.465 N ZBTB4 n/a
8 TRCN0000280404 GCCCAAGCTCAATACACTCAA pLKO_005 1375 CDS 100% 4.950 3.465 N ZBTB4 n/a
9 TRCN0000204795 GTGTCAGATCACTGTGCGAAT pLKO.1 1960 CDS 100% 4.050 2.835 N Zbtb4 n/a
10 TRCN0000015783 GAGACCTTTGTCACTTACTAT pLKO.1 1271 CDS 100% 5.625 3.375 N ZBTB4 n/a
11 TRCN0000297844 GAGACCTTTGTCACTTACTAT pLKO_005 1271 CDS 100% 5.625 3.375 N ZBTB4 n/a
12 TRCN0000186929 GATGTCCTCAACTTCATCTAT pLKO.1 569 CDS 100% 5.625 3.938 N Zbtb4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006721564.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08754 pDONR223 100% 99.9% 99.8% None 562C>T;2020C>T n/a
Download CSV