Transcript: Human XM_006721670.3

PREDICTED: Homo sapiens 5'-nucleotidase, cytosolic IIIB (NT5C3B), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NT5C3B (115024)
Length:
1407
CDS:
292..1065

Additional Resources:

NCBI RefSeq record:
XM_006721670.3
NBCI Gene record:
NT5C3B (115024)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006721670.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000142367 GTCAAGGAGAAGCTACCTCAT pLKO.1 445 CDS 100% 4.050 5.670 N NT5C3B n/a
2 TRCN0000142486 GCGATGCCCTTCTTCTTACAA pLKO.1 324 CDS 100% 5.625 4.500 N NT5C3B n/a
3 TRCN0000419928 AGCGCTCCTTCACCACTATTA pLKO_005 396 CDS 100% 13.200 9.240 N NT5C3B n/a
4 TRCN0000430064 CTTCATCACCAGAGGCTTGAA pLKO_005 1213 3UTR 100% 4.950 3.465 N NT5C3B n/a
5 TRCN0000142018 GACCTTGAGCAGGTTTGCATA pLKO.1 294 CDS 100% 4.950 3.465 N NT5C3B n/a
6 TRCN0000121916 CAATCTCCTATGTCAGCAGAA pLKO.1 492 CDS 100% 4.050 2.835 N NT5C3B n/a
7 TRCN0000141259 CTATGACATCGTGCTGGAGAA pLKO.1 963 CDS 100% 4.050 2.835 N NT5C3B n/a
8 TRCN0000421992 GCACTGTTCCTGGTGAACCTT pLKO_005 1261 3UTR 100% 3.000 2.100 N NT5C3B n/a
9 TRCN0000141880 GAAGTTTCAGATAGCCCAGGT pLKO.1 519 CDS 100% 2.160 1.512 N NT5C3B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006721670.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13046 pDONR223 100% 99.4% 99.2% None (many diffs) n/a
2 ccsbBroad304_13046 pLX_304 0% 99.4% 99.2% V5 (many diffs) n/a
3 TRCN0000473044 ACGGGCCTAAATAGGACCCCTGAT pLX_317 62% 99.4% 99.2% V5 (many diffs) n/a
Download CSV