Transcript: Human XM_006721687.4

PREDICTED: Homo sapiens HEXIM P-TEFb complex subunit 2 (HEXIM2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HEXIM2 (124790)
Length:
2135
CDS:
975..1904

Additional Resources:

NCBI RefSeq record:
XM_006721687.4
NBCI Gene record:
HEXIM2 (124790)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006721687.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000371070 CGAAGAGATGTTCGCCAAAGG pLKO_005 1427 CDS 100% 4.050 5.670 N HEXIM2 n/a
2 TRCN0000254101 CCACCCAGTTCCTGATGAATG pLKO_005 1471 CDS 100% 10.800 7.560 N HEXIM2 n/a
3 TRCN0000254102 CAAGGAGAAGGTCCCATTTCG pLKO_005 1929 3UTR 100% 4.950 3.465 N HEXIM2 n/a
4 TRCN0000179783 GAAGGACTTCTCTGAGACTTA pLKO.1 1613 CDS 100% 4.950 3.465 N HEXIM2 n/a
5 TRCN0000265472 TTCGTCAGGAGAACCAGATGT pLKO_005 1840 CDS 100% 4.950 3.465 N HEXIM2 n/a
6 TRCN0000371074 ACTTCTCTGAGACTTACGAAC pLKO_005 1618 CDS 100% 4.050 2.835 N HEXIM2 n/a
7 TRCN0000371073 TGAGAAACAACAGCGGGATGA pLKO_005 1376 CDS 100% 4.050 2.835 N HEXIM2 n/a
8 TRCN0000179348 GACTTCTCTGAGACTTACGAA pLKO.1 1617 CDS 100% 3.000 2.100 N HEXIM2 n/a
9 TRCN0000377620 AGGTCCCATTTCGTGCACACT pLKO_005 1937 3UTR 100% 2.640 1.848 N HEXIM2 n/a
10 TRCN0000371013 GAGACTTACGAACGCTTCCAC pLKO_005 1626 CDS 100% 2.640 1.848 N HEXIM2 n/a
11 TRCN0000371075 AGAGCCACTCAGAGGATGAAG pLKO_005 1192 CDS 100% 4.950 2.970 N HEXIM2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006721687.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04789 pDONR223 100% 92.5% 92.5% None 1_69del n/a
2 ccsbBroad304_04789 pLX_304 0% 92.5% 92.5% V5 1_69del n/a
3 TRCN0000465918 TGGCTCCTCACAGTAAGTGCAGAC pLX_317 40.6% 92.5% 92.5% V5 1_69del n/a
Download CSV