Transcript: Human XM_006721798.4

PREDICTED: Homo sapiens syntaxin binding protein 4 (STXBP4), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
STXBP4 (252983)
Length:
1212
CDS:
208..1170

Additional Resources:

NCBI RefSeq record:
XM_006721798.4
NBCI Gene record:
STXBP4 (252983)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006721798.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000380252 ATGTTGGTGCACATGAAATTT pLKO_005 1022 CDS 100% 15.000 10.500 N STXBP4 n/a
2 TRCN0000428653 TACTGTGGGTTTGTCTAATAC pLKO_005 759 CDS 100% 13.200 9.240 N STXBP4 n/a
3 TRCN0000380421 TAAATCCCTCTGTTCGCTTTA pLKO_005 833 CDS 100% 10.800 7.560 N STXBP4 n/a
4 TRCN0000117835 GCTTGGGAGATAGCATTCATA pLKO.1 505 CDS 100% 5.625 3.938 N STXBP4 n/a
5 TRCN0000117833 CCGACAACATTCAGCCAGAAA pLKO.1 536 CDS 100% 4.950 3.465 N STXBP4 n/a
6 TRCN0000379647 GGACCTCAAGCCTCAACATTA pLKO_005 598 CDS 100% 13.200 7.920 N STXBP4 n/a
7 TRCN0000117836 GTGTATCATTTGAAGAAGCAA pLKO.1 446 CDS 100% 3.000 1.800 N STXBP4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006721798.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13447 pDONR223 100% 59.9% 59.1% None (many diffs) n/a
2 ccsbBroad304_13447 pLX_304 0% 59.9% 59.1% V5 (many diffs) n/a
3 TRCN0000475020 GGAGTATTTGACGGATTCCCAAGG pLX_317 37.5% 59.9% 59.1% V5 (many diffs) n/a
Download CSV