Transcript: Human XM_006721802.3

PREDICTED: Homo sapiens HEAT repeat containing 9 (HEATR9), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HEATR9 (256957)
Length:
1461
CDS:
178..1344

Additional Resources:

NCBI RefSeq record:
XM_006721802.3
NBCI Gene record:
HEATR9 (256957)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006721802.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000155539 GCTCAAGTTGAAGCCTACGAT pLKO.1 819 CDS 100% 3.000 4.200 N HEATR9 n/a
2 TRCN0000150695 GCTAGAGGAACTCACATTTAA pLKO.1 726 CDS 100% 15.000 10.500 N HEATR9 n/a
3 TRCN0000412746 ACCCAGAAGAGTTAACTATTC pLKO_005 1136 CDS 100% 10.800 7.560 N HEATR9 n/a
4 TRCN0000428610 TACGCATCAGTGACAAGTTTG pLKO_005 155 5UTR 100% 10.800 7.560 N HEATR9 n/a
5 TRCN0000155265 GCACAACTGATGAACCCAGAT pLKO.1 856 CDS 100% 4.050 2.835 N HEATR9 n/a
6 TRCN0000154520 GCCTACGATGATGAACTTGGT pLKO.1 831 CDS 100% 2.640 1.848 N HEATR9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006721802.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09918 pDONR223 100% 68% 68% None 0_1ins546 n/a
2 ccsbBroad304_09918 pLX_304 0% 68% 68% V5 0_1ins546 n/a
3 TRCN0000470686 TATCTAGGGATAAAATCTACCATT pLX_317 23.2% 68% 68% V5 0_1ins546 n/a
Download CSV