Transcript: Human XM_006722083.3

PREDICTED: Homo sapiens DEAH-box helicase 40 (DHX40), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DHX40 (79665)
Length:
2732
CDS:
79..2337

Additional Resources:

NCBI RefSeq record:
XM_006722083.3
NBCI Gene record:
DHX40 (79665)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006722083.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000051378 CGCAAGAATTGTATGCCCAAT pLKO.1 2037 CDS 100% 4.050 5.670 N DHX40 n/a
2 TRCN0000299549 CGCAAGAATTGTATGCCCAAT pLKO_005 2037 CDS 100% 4.050 5.670 N DHX40 n/a
3 TRCN0000051380 CCCAAGTTGCATGAATTTAAT pLKO.1 2086 CDS 100% 15.000 10.500 N DHX40 n/a
4 TRCN0000299613 CCCAAGTTGCATGAATTTAAT pLKO_005 2086 CDS 100% 15.000 10.500 N DHX40 n/a
5 TRCN0000051379 GCTCAGAGAGTAGCTGAAGAA pLKO.1 421 CDS 100% 4.950 3.465 N DHX40 n/a
6 TRCN0000299546 GCTCAGAGAGTAGCTGAAGAA pLKO_005 421 CDS 100% 4.950 3.465 N DHX40 n/a
7 TRCN0000051381 CATTCCTTATTGTTACTGGAA pLKO.1 287 CDS 100% 2.640 1.848 N DHX40 n/a
8 TRCN0000051382 GAGACCTTTGAAGGCCCTAAA pLKO.1 1822 CDS 100% 10.800 6.480 N DHX40 n/a
9 TRCN0000299612 GAGACCTTTGAAGGCCCTAAA pLKO_005 1822 CDS 100% 10.800 6.480 N DHX40 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006722083.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04103 pDONR223 100% 96.5% 96.5% None 1341_1342ins81 n/a
2 ccsbBroad304_04103 pLX_304 0% 96.5% 96.5% V5 1341_1342ins81 n/a
3 TRCN0000471261 CTTACCCAGAGGAGATCAAATCAA pLX_317 13.6% 96.5% 96.5% V5 1341_1342ins81 n/a
Download CSV