Transcript: Human XM_006722392.3

PREDICTED: Homo sapiens tetratricopeptide repeat domain 39C (TTC39C), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TTC39C (125488)
Length:
4416
CDS:
641..1630

Additional Resources:

NCBI RefSeq record:
XM_006722392.3
NBCI Gene record:
TTC39C (125488)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006722392.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000148637 CTTGACTTCTGATGCTGCAAA pLKO.1 1213 CDS 100% 4.950 3.465 N TTC39C n/a
2 TRCN0000130810 GCCATGATGACATTTGAGGAA pLKO.1 860 CDS 100% 2.640 1.848 N TTC39C n/a
3 TRCN0000416271 AGTTGGCATGTGATGACTTAA pLKO_005 891 CDS 100% 13.200 7.920 N TTC39C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006722392.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04799 pDONR223 100% 45.9% 45.7% None 1_183del;984_985insTGTC;987_988ins758 n/a
2 ccsbBroad304_04799 pLX_304 0% 45.9% 45.7% V5 1_183del;984_985insTGTC;987_988ins758 n/a
3 TRCN0000470153 TCACATTCGCGATCGCCTGCACAT pLX_317 28.3% 45.9% 45.7% V5 1_183del;984_985insTGTC;987_988ins758 n/a
Download CSV