Transcript: Human XM_006722639.3

PREDICTED: Homo sapiens Purkinje cell protein 2 (PCP2), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PCP2 (126006)
Length:
1054
CDS:
680..979

Additional Resources:

NCBI RefSeq record:
XM_006722639.3
NBCI Gene record:
PCP2 (126006)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006722639.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257484 CATGGATGACCAACGTGTGAC pLKO_005 799 CDS 100% 4.050 5.670 N PCP2 n/a
2 TRCN0000246093 ACCAGGAGGGCTTCTTCAATC pLKO_005 633 5UTR 100% 10.800 7.560 N PCP2 n/a
3 TRCN0000257491 TCCAAGGACGGAGCACAGAAA pLKO_005 854 CDS 100% 4.950 3.465 N PCP2 n/a
4 TRCN0000257488 GATGGACAGCCTCATGGACAT pLKO_005 754 CDS 100% 4.050 2.835 N PCP2 n/a
5 TRCN0000257482 ATGGAGGGACAGCGCTGTTCA pLKO_005 680 CDS 100% 1.650 1.155 N PCP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006722639.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04806 pDONR223 100% 72.7% 72.7% None 0_1ins111 n/a
2 ccsbBroad304_04806 pLX_304 0% 72.7% 72.7% V5 0_1ins111 n/a
3 TRCN0000479812 CGCATTCCAGTCTCCTTAGGTTAC pLX_317 79.1% 72.7% 72.7% V5 0_1ins111 n/a
Download CSV