Transcript: Human XM_006723149.2

PREDICTED: Homo sapiens zinc finger and SCAN domain containing 1 (ZSCAN1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZSCAN1 (284312)
Length:
7943
CDS:
1741..3087

Additional Resources:

NCBI RefSeq record:
XM_006723149.2
NBCI Gene record:
ZSCAN1 (284312)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006723149.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432013 TGTTGCAGGCATCTCGGTAGT pLKO_005 2685 CDS 100% 4.050 5.670 N ZSCAN1 n/a
2 TRCN0000015939 CCATCCCTCAAGCACACCAAA pLKO.1 2647 CDS 100% 4.950 3.465 N ZSCAN1 n/a
3 TRCN0000433272 ATGTGCCAGCAGGAAGTTCTG pLKO_005 2215 CDS 100% 4.050 2.835 N ZSCAN1 n/a
4 TRCN0000422296 CACAAGCTGTTTCTCGGAAGA pLKO_005 3213 3UTR 100% 4.050 2.835 N ZSCAN1 n/a
5 TRCN0000015941 CCACTTCATCGAGCACCAGAA pLKO.1 2775 CDS 100% 4.050 2.835 N ZSCAN1 n/a
6 TRCN0000015940 GAAGAGTCCAAGGTCCCAGAA pLKO.1 2292 CDS 100% 4.050 2.835 N ZSCAN1 n/a
7 TRCN0000015938 CCCTGGATGGTCCACCTCATT pLKO.1 3028 CDS 100% 1.650 0.990 N ZSCAN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006723149.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13523 pDONR223 100% 36.1% 30% None (many diffs) n/a
2 ccsbBroad304_13523 pLX_304 0% 36.1% 30% V5 (many diffs) n/a
3 TRCN0000471331 AGCATCAGCGTCTGGCTGGGGGAA pLX_317 77.6% 36.1% 30% V5 (many diffs) n/a
Download CSV