Transcript: Human XM_006723428.3

PREDICTED: Homo sapiens TEA domain transcription factor 2 (TEAD2), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TEAD2 (8463)
Length:
2525
CDS:
492..1796

Additional Resources:

NCBI RefSeq record:
XM_006723428.3
NBCI Gene record:
TEAD2 (8463)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006723428.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000013204 CCCGAAGGAAATCAAGGGAAA pLKO.1 814 CDS 100% 4.050 5.670 N TEAD2 n/a
2 TRCN0000013205 CCGGCAGATCTACGACAAATT pLKO.1 1304 CDS 100% 13.200 10.560 N TEAD2 n/a
3 TRCN0000013203 GCTCACCTCATGCTTCTTATT pLKO.1 1857 3UTR 100% 13.200 9.240 N TEAD2 n/a
4 TRCN0000425142 TGCGAGTACCTGGTGAATTTC pLKO_005 1590 CDS 100% 13.200 9.240 N TEAD2 n/a
5 TRCN0000426430 ATGACCTGTGAGATCACAAAG pLKO_005 2255 3UTR 100% 10.800 7.560 N TEAD2 n/a
6 TRCN0000013207 CCAAGTTGAAGGACCAGGTTT pLKO.1 841 CDS 100% 4.950 3.465 N TEAD2 n/a
7 TRCN0000013206 GCCTGAGCGATACATGATGAA pLKO.1 1631 CDS 100% 4.950 3.465 N TEAD2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006723428.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01933 pDONR223 100% 97% 97% None 1036_1037ins39 n/a
2 ccsbBroad304_01933 pLX_304 0% 97% 97% V5 1036_1037ins39 n/a
3 TRCN0000478936 GGACGTCCGAAGGAGACCATATTC pLX_317 31.9% 97% 97% V5 1036_1037ins39 n/a
Download CSV