Transcript: Human XM_006723436.3

PREDICTED: Homo sapiens zinc finger protein 607 (ZNF607), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF607 (84775)
Length:
4316
CDS:
555..2642

Additional Resources:

NCBI RefSeq record:
XM_006723436.3
NBCI Gene record:
ZNF607 (84775)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006723436.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430152 GCTGATGGAAATCCCTATATG pLKO_005 2469 CDS 100% 13.200 18.480 N ZNF607 n/a
2 TRCN0000431096 GGAAGTCCTTTAGGCTCAATT pLKO_005 1747 CDS 100% 13.200 18.480 N ZNF607 n/a
3 TRCN0000430482 GGAAGTCCTTTAGGCTCAAAG pLKO_005 1327 CDS 100% 10.800 15.120 N ZNF607 n/a
4 TRCN0000021170 GCCTCATATATCATGACCGAA pLKO.1 2275 CDS 100% 2.640 3.696 N ZNF607 n/a
5 TRCN0000021171 GCCCATCATAACAGAATTCAT pLKO.1 1860 CDS 100% 0.000 0.000 N ZNF607 n/a
6 TRCN0000412821 TATGACAACTTAGTCTCATTG pLKO_005 669 CDS 100% 10.800 8.640 N ZNF607 n/a
7 TRCN0000021173 GAAGGTCCTTTAGGCTTAGAT pLKO.1 2587 CDS 100% 5.625 4.500 N ZNF607 n/a
8 TRCN0000428200 ACATTGTGTCAATGGATTTAT pLKO_005 2680 3UTR 100% 15.000 10.500 N ZNF607 n/a
9 TRCN0000428156 CCGTATCTAAGCCAGATTTAA pLKO_005 697 CDS 100% 15.000 10.500 N ZNF607 n/a
10 TRCN0000428352 GATGATGGGAAAGGCTATTTA pLKO_005 3060 3UTR 100% 15.000 10.500 N ZNF607 n/a
11 TRCN0000425026 GTCATGCTTCACATCTTATTA pLKO_005 2347 CDS 100% 15.000 10.500 N ZNF607 n/a
12 TRCN0000413758 TAGGTTCATTTCTGTACTTAA pLKO_005 2177 CDS 100% 13.200 9.240 N ZNF607 n/a
13 TRCN0000414093 TAGGACTAGCCGTCAACTTAC pLKO_005 1169 CDS 100% 10.800 7.560 N ZNF607 n/a
14 TRCN0000021172 CTGCACCTCATACATTTGAAA pLKO.1 1609 CDS 100% 5.625 3.938 N ZNF607 n/a
15 TRCN0000021169 GCCTTTAGTGTATCTGGACAA pLKO.1 2088 CDS 100% 4.050 2.835 N ZNF607 n/a
16 TRCN0000152004 CTGGTGAGAAACCTTATGAAT pLKO.1 2050 CDS 100% 5.625 2.813 Y ZNF829 n/a
17 TRCN0000284648 ATACAGGAGAGAAACCCTATA pLKO_005 1963 CDS 100% 10.800 5.400 Y Gm14308 n/a
18 TRCN0000147970 GAATGTAAGGAATGTGGGAAA pLKO.1 2067 CDS 100% 4.050 2.025 Y ZNF700 n/a
19 TRCN0000152739 GTAAGGAATGTGGAAAGGCTT pLKO.1 1399 CDS 100% 2.640 1.320 Y ZNF829 n/a
20 TRCN0000262238 TACAGGAGAGAAACCCTATAA pLKO_005 1964 CDS 100% 13.200 6.600 Y Gm14305 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006723436.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14315 pDONR223 100% 53.2% 53.2% None 1_972del;1413A>G;1589A>G n/a
2 ccsbBroad304_14315 pLX_304 0% 53.2% 53.2% V5 1_972del;1413A>G;1589A>G n/a
3 TRCN0000480129 CCGACAATGCCAACACCTTACCCC pLX_317 36.9% 53.2% 53.2% V5 1_972del;1413A>G;1589A>G n/a
Download CSV