Transcript: Human XM_006723473.2

PREDICTED: Homo sapiens cytohesin 2 (CYTH2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CYTH2 (9266)
Length:
1505
CDS:
321..1505

Additional Resources:

NCBI RefSeq record:
XM_006723473.2
NBCI Gene record:
CYTH2 (9266)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006723473.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000233533 CTGTACGACAGCATCCGAAAT pLKO_005 1086 CDS 100% 10.800 15.120 N CYTH2 n/a
2 TRCN0000233534 CCGAACTGCTTTGAACTTTAC pLKO_005 1344 CDS 100% 10.800 7.560 N CYTH2 n/a
3 TRCN0000062101 CAGTTCTTGGTGGAGAATGAA pLKO.1 627 CDS 100% 5.625 3.938 N CYTH2 n/a
4 TRCN0000062100 CGGAAACCGAACTGCTTTGAA pLKO.1 1338 CDS 100% 5.625 3.938 N CYTH2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006723473.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15663 pDONR223 0% 31.7% 34.2% None (many diffs) n/a
2 ccsbBroad304_15663 pLX_304 0% 31.7% 34.2% V5 (many diffs) n/a
3 TRCN0000467209 ATCGCCCAGGGTACGTTCCTAGCC pLX_317 8% 31.7% 34.2% V5 (many diffs) n/a
Download CSV