Transcript: Human XM_006723475.2

PREDICTED: Homo sapiens SH3KBP1 binding protein 1 (SHKBP1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SHKBP1 (92799)
Length:
2379
CDS:
37..2187

Additional Resources:

NCBI RefSeq record:
XM_006723475.2
NBCI Gene record:
SHKBP1 (92799)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006723475.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429595 GAGAGGAGTTGGATCGATCTT pLKO_005 374 CDS 100% 4.950 6.930 N SHKBP1 n/a
2 TRCN0000429744 ACGTCCTCTTCAATGGTTACC pLKO_005 404 CDS 100% 4.050 5.670 N SHKBP1 n/a
3 TRCN0000134457 GAAGCTCAATGAAACTTCCTT pLKO.1 2163 CDS 100% 3.000 2.400 N SHKBP1 n/a
4 TRCN0000138830 GAAAGATGAGACCGGAGCAAT pLKO.1 204 CDS 100% 4.950 3.465 N SHKBP1 n/a
5 TRCN0000434887 GACGACCAGCAAGTGTTCATC pLKO_005 1576 CDS 100% 4.950 3.465 N SHKBP1 n/a
6 TRCN0000433954 TCAGTCTGTGCCGACAACAAC pLKO_005 1399 CDS 100% 4.950 3.465 N SHKBP1 n/a
7 TRCN0000427147 TGCGCACCAAAGAGTTGGATC pLKO_005 272 CDS 100% 4.050 2.835 N SHKBP1 n/a
8 TRCN0000135431 GTTTCTAGTCTGCTACAGGTT pLKO.1 672 CDS 100% 2.640 1.848 N SHKBP1 n/a
9 TRCN0000138051 CATGAAAGACAACGACCTCCT pLKO.1 1107 CDS 100% 2.160 1.512 N SHKBP1 n/a
10 TRCN0000137836 GCTTCCTTTAAGATCCTGGCT pLKO.1 1489 CDS 100% 0.660 0.396 N SHKBP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006723475.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09350 pDONR223 100% 98.3% 98.3% None (many diffs) n/a
2 ccsbBroad304_09350 pLX_304 0% 98.3% 98.3% V5 (many diffs) n/a
3 TRCN0000479316 AATACTTACCACCTTTATCTGGTA pLX_317 17.7% 98.3% 98.3% V5 (many diffs) n/a
Download CSV