Transcript: Human XM_006723734.3

PREDICTED: Homo sapiens endothelin 3 (EDN3), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EDN3 (1908)
Length:
2712
CDS:
398..1024

Additional Resources:

NCBI RefSeq record:
XM_006723734.3
NBCI Gene record:
EDN3 (1908)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006723734.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000117876 CCTATGGACTGTCCAACTACA pLKO.1 774 CDS 100% 4.950 6.930 N EDN3 n/a
2 TRCN0000117875 GTAATTCAAGGACGGCAGAAA pLKO.1 939 CDS 100% 4.950 6.930 N EDN3 n/a
3 TRCN0000372055 CATAGCTCTACAGGAGTTTAT pLKO_005 1671 3UTR 100% 13.200 10.560 N EDN3 n/a
4 TRCN0000372111 TGCACGTGCTTCACCTACAAG pLKO_005 686 CDS 100% 4.950 3.960 N EDN3 n/a
5 TRCN0000117874 ACAAGGAGTGTGTCTACTATT pLKO.1 708 CDS 100% 13.200 9.240 N EDN3 n/a
6 TRCN0000117872 CCTTGATGTTTGTGACAAGAA pLKO.1 1794 3UTR 100% 4.950 3.465 N EDN3 n/a
7 TRCN0000117873 GTTGAAGTCAAGGACCAACAA pLKO.1 1051 3UTR 100% 4.950 3.465 N EDN3 n/a
8 TRCN0000372054 CATGTCCATCTTGTAATAAAT pLKO_005 1543 3UTR 100% 15.000 9.000 N EDN3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006723734.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00479 pDONR223 100% 83.9% 82.1% None (many diffs) n/a
2 ccsbBroad304_00479 pLX_304 0% 83.9% 82.1% V5 (many diffs) n/a
3 TRCN0000467255 GGCCCACATTTACCTATTGACTTG pLX_317 67.8% 83.9% 82.1% V5 (many diffs) n/a
Download CSV