Transcript: Human XM_006724028.3

PREDICTED: Homo sapiens melanocortin 2 receptor accessory protein (MRAP), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MRAP (56246)
Length:
930
CDS:
118..636

Additional Resources:

NCBI RefSeq record:
XM_006724028.3
NBCI Gene record:
MRAP (56246)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006724028.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000179878 CGTTCTTCTTAGAGGCCATTT pLKO.1 705 3UTR 100% 10.800 15.120 N MRAP n/a
2 TRCN0000146428 CATACGTTCCTCGTTCTTCTT pLKO.1 694 3UTR 100% 4.950 6.930 N MRAP n/a
3 TRCN0000427942 CAGAGCTGATGTCAGTAAATC pLKO_005 628 CDS 100% 13.200 9.240 N MRAP n/a
4 TRCN0000421853 TCTGGGAACTGACCCTCAATG pLKO_005 545 CDS 100% 10.800 7.560 N MRAP n/a
5 TRCN0000418512 TGGACTATCTGGACCTCATTC pLKO_005 170 CDS 100% 10.800 7.560 N MRAP n/a
6 TRCN0000148933 CCACAAACATTCCATCGTGAT pLKO.1 216 CDS 100% 4.050 2.835 N MRAP n/a
7 TRCN0000149100 GAAAGCCCACAAACATTCCAT pLKO.1 210 CDS 100% 3.000 2.100 N MRAP n/a
8 TRCN0000149212 GCATCCTATGCCTTTGACAAA pLKO.1 772 3UTR 100% 4.950 2.970 N MRAP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006724028.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08636 pDONR223 100% 99.6% 100% None 132G>T;390C>G n/a
2 ccsbBroad304_08636 pLX_304 0% 99.6% 100% V5 132G>T;390C>G n/a
3 TRCN0000473673 TTTGCCCAGCCCTCCACAGTGATT pLX_317 53.9% 99.6% 100% V5 132G>T;390C>G n/a
Download CSV