Transcript: Human XM_006724775.2

PREDICTED: Homo sapiens RAP2C, member of RAS oncogene family (RAP2C), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RAP2C (57826)
Length:
3663
CDS:
713..1066

Additional Resources:

NCBI RefSeq record:
XM_006724775.2
NBCI Gene record:
RAP2C (57826)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006724775.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419476 CACGTTTACCATACGTTTAAA pLKO_005 1273 3UTR 100% 15.000 21.000 N RAP2C n/a
2 TRCN0000366700 TCGTCAGGCAAATGAACTATT pLKO_005 993 CDS 100% 13.200 18.480 N Rap2c n/a
3 TRCN0000048175 CCCACTAATCCTAGTAGGAAA pLKO.1 841 CDS 100% 4.950 6.930 N RAP2C n/a
4 TRCN0000048174 GCCTGGTTAATCAACAGTCTT pLKO.1 762 CDS 100% 4.950 3.960 N RAP2C n/a
5 TRCN0000422345 GCTAATATACAAGGGTTAATT pLKO_005 1346 3UTR 100% 15.000 10.500 N RAP2C n/a
6 TRCN0000436764 CAGAGCTCTGGCTCAAGAATG pLKO_005 907 CDS 100% 10.800 7.560 N RAP2C n/a
7 TRCN0000048173 CCTGGTTTATAGCCTGGTTAA pLKO.1 751 CDS 100% 10.800 7.560 N RAP2C n/a
8 TRCN0000048177 AGAAGCAAGATCAGTGTTGTA pLKO.1 1026 CDS 100% 4.950 3.465 N RAP2C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006724775.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08770 pDONR223 100% 63.7% 63.3% None 0_1ins198;206C>T n/a
2 ccsbBroad304_08770 pLX_304 0% 63.7% 63.3% V5 0_1ins198;206C>T n/a
3 TRCN0000466597 GGCAAACCACCGGTAATATGTCGA pLX_317 51.3% 63.7% 63.3% V5 0_1ins198;206C>T n/a
Download CSV