Transcript: Mouse XM_011238467.2

PREDICTED: Mus musculus special AT-rich sequence binding protein 2 (Satb2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Satb2 (212712)
Length:
5402
CDS:
378..2600

Additional Resources:

NCBI RefSeq record:
XM_011238467.2
NBCI Gene record:
Satb2 (212712)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011238467.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000085149 CGCTGAAGATCCAATTACAAA pLKO.1 850 CDS 100% 5.625 7.875 N Satb2 n/a
2 TRCN0000020684 GCCATTTATGACGAGATCCAA pLKO.1 1854 CDS 100% 3.000 2.400 N SATB2 n/a
3 TRCN0000085152 CAGGGATTATTGTCAGAGATA pLKO.1 1569 CDS 100% 4.950 3.465 N Satb2 n/a
4 TRCN0000020687 GCCTTAAAGGAACTGCTCAAA pLKO.1 930 CDS 100% 4.950 3.465 N SATB2 n/a
5 TRCN0000085151 GCGTCTCAGTCTCTTCTAGTA pLKO.1 1617 CDS 100% 4.950 3.465 N Satb2 n/a
6 TRCN0000085148 CCCACGAGATAAATGAAGGAA pLKO.1 2923 3UTR 100% 3.000 2.100 N Satb2 n/a
7 TRCN0000085150 CGCACAAAGATCTCTTTGGAA pLKO.1 2250 CDS 100% 0.300 0.210 N Satb2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011238467.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02751 pDONR223 100% 91.5% 98.6% None (many diffs) n/a
2 ccsbBroad304_02751 pLX_304 0% 91.5% 98.6% V5 (many diffs) n/a
3 TRCN0000468644 GTGCTTGGTGTGTATATTGGTGTA pLX_317 17.8% 91.5% 98.6% V5 (many diffs) n/a
Download CSV