Transcript: Mouse XM_011238485.2

PREDICTED: Mus musculus ARP1 actin-related protein 1B, centractin beta (Actr1b), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Actr1b (226977)
Length:
2067
CDS:
193..1191

Additional Resources:

NCBI RefSeq record:
XM_011238485.2
NBCI Gene record:
Actr1b (226977)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011238485.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000090529 CGGGATTGGAATGACATGGAA pLKO.1 301 CDS 100% 3.000 2.400 N Actr1b n/a
2 TRCN0000316057 CGGGATTGGAATGACATGGAA pLKO_005 301 CDS 100% 3.000 2.400 N Actr1b n/a
3 TRCN0000090530 CCGGACACTCTTCTCCAATAT pLKO.1 933 CDS 100% 13.200 9.240 N Actr1b n/a
4 TRCN0000316134 CCGGACACTCTTCTCCAATAT pLKO_005 933 CDS 100% 13.200 9.240 N Actr1b n/a
5 TRCN0000090531 ACAGGTTACTAAGTGAAGTAA pLKO.1 995 CDS 100% 0.563 0.394 N Actr1b n/a
6 TRCN0000316059 ACAGGTTACTAAGTGAAGTAA pLKO_005 995 CDS 100% 0.563 0.394 N Actr1b n/a
7 TRCN0000090528 CCACTCTCTTTCAAAGCACTA pLKO.1 1794 3UTR 100% 4.050 2.430 N Actr1b n/a
8 TRCN0000316132 CCACTCTCTTTCAAAGCACTA pLKO_005 1794 3UTR 100% 4.050 2.430 N Actr1b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011238485.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07555 pDONR223 100% 78.5% 87.2% None (many diffs) n/a
2 ccsbBroad304_07555 pLX_304 0% 78.5% 87.2% V5 (many diffs) n/a
3 TRCN0000465969 GCCACCGGCCCCGTCGATTCAGTA pLX_317 38.1% 78.5% 87.2% V5 (many diffs) n/a
4 ccsbBroadEn_07554 pDONR223 100% 78.4% 86.9% None (many diffs) n/a
5 ccsbBroad304_07554 pLX_304 0% 78.4% 86.9% V5 (many diffs) n/a
6 TRCN0000471351 ATAATAAATACATTTACAGATCGA pLX_317 45.1% 78.4% 86.9% V5 (many diffs) n/a
Download CSV