Transcript: Mouse XM_011238531.1

PREDICTED: Mus musculus cyclin-dependent kinase 15 (Cdk15), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cdk15 (271697)
Length:
1392
CDS:
252..1040

Additional Resources:

NCBI RefSeq record:
XM_011238531.1
NBCI Gene record:
Cdk15 (271697)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011238531.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000023262 CTGCCTAACTACAATCCAGAA pLKO.1 678 CDS 100% 4.050 5.670 N Cdk15 n/a
2 TRCN0000368002 ACGAAGCTTCGTGCCCTATTT pLKO_005 1086 3UTR 100% 13.200 9.240 N Cdk15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011238531.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12510 pDONR223 100% 46.8% 47.8% None (many diffs) n/a
2 ccsbBroad304_12510 pLX_304 0% 46.8% 47.8% V5 (many diffs) n/a
3 TRCN0000467466 AAAGGGTTGCCTAGCCCCCAAGGT pLX_317 7.9% 46.8% 47.8% V5 (many diffs) n/a
4 ccsbBroadEn_15139 pDONR223 0% 46.8% 47.8% None (many diffs) n/a
5 ccsbBroad304_15139 pLX_304 0% 46.8% 47.8% V5 (many diffs) n/a
6 TRCN0000480211 AGCAATTCTAAGCAATCTCCAACG pLX_317 35.3% 46.8% 47.8% V5 (many diffs) n/a
Download CSV