Construct: ORF TRCN0000480211
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF010026.4_s317c1
- Derived from:
- ccsbBroadEn_15139
- DNA Barcode:
- AGCAATTCTAAGCAATCTCCAACG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CDK15 (65061)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480211
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 65061 | CDK15 | cyclin dependent kinase 15 | NM_139158.2 | 90.8% | 90.8% | 1048_1152del |
| 2 | human | 65061 | CDK15 | cyclin dependent kinase 15 | XM_005246782.4 | 90.8% | 90.8% | 1048_1152del |
| 3 | human | 65061 | CDK15 | cyclin dependent kinase 15 | NM_001261436.1 | 87.2% | 87.2% | 1_153del |
| 4 | human | 65061 | CDK15 | cyclin dependent kinase 15 | XM_011511650.2 | 84.7% | 84.4% | 1_153del;1199_1202delTCAC;1205_1236del |
| 5 | human | 65061 | CDK15 | cyclin dependent kinase 15 | NM_001261435.1 | 81.3% | 81.1% | 1_153del;1199_1202delTTTC;1205_1287del |
| 6 | human | 65061 | CDK15 | cyclin dependent kinase 15 | NM_001366386.1 | 80.2% | 80.2% | 1_153del;1201_1305del |
| 7 | human | 65061 | CDK15 | cyclin dependent kinase 15 | XM_011511652.1 | 75.8% | 74% | (many diffs) |
| 8 | human | 65061 | CDK15 | cyclin dependent kinase 15 | XM_011511654.2 | 72.9% | 72.5% | (many diffs) |
| 9 | human | 65061 | CDK15 | cyclin dependent kinase 15 | XM_011511655.2 | 57.2% | 57.2% | 0_1ins387;661_765del |
| 10 | human | 65061 | CDK15 | cyclin dependent kinase 15 | XM_011511656.2 | 57.2% | 57.2% | 0_1ins387;661_765del |
| 11 | human | 65061 | CDK15 | cyclin dependent kinase 15 | XR_922991.2 | 54.3% | 1_239del;937_1075del;1153_1154ins272 | |
| 12 | human | 65061 | CDK15 | cyclin dependent kinase 15 | XM_011511657.2 | 53.1% | 52% | (many diffs) |
| 13 | human | 65061 | CDK15 | cyclin dependent kinase 15 | XR_922990.1 | 27.1% | 1_239del;1092_1093ins49;1238_3624del | |
| 14 | mouse | 271697 | Cdk15 | cyclin-dependent kinase 15 | NM_001033373.2 | 72.8% | 75.5% | (many diffs) |
| 15 | mouse | 271697 | Cdk15 | cyclin-dependent kinase 15 | XM_006496050.3 | 72.6% | 75.5% | (many diffs) |
| 16 | mouse | 271697 | Cdk15 | cyclin-dependent kinase 15 | XM_006496048.3 | 70.3% | 72.9% | (many diffs) |
| 17 | mouse | 271697 | Cdk15 | cyclin-dependent kinase 15 | XM_006496049.3 | 70.2% | 72.9% | (many diffs) |
| 18 | mouse | 271697 | Cdk15 | cyclin-dependent kinase 15 | XR_373255.3 | 54.3% | (many diffs) | |
| 19 | mouse | 271697 | Cdk15 | cyclin-dependent kinase 15 | XM_011238531.1 | 46.8% | 47.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1113
- ORF length:
- 1047
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgac ttcatttcac cccaggggac ttcaagctgc ccgtgcccag aagttcaaga 121 gtaaaaggcc acggagtaac agtgattgtt ttcaggaaga ggatctgagg cagggttttc 181 agtggaggaa gagcctccct tttggggcag cctcatctta cttgaacttg gagaagctgg 241 gtgaaggctc ttatgcgaca gtttacaagg ggattagcag aataaatgga caactagtgg 301 ctttaaaagt catcagcatg aatgcagagg aaggagtccc atttacagct atccgagaag 361 cttctctcct gaagggtttg aaacatgcca atattgtgct cctgcatgac ataatccaca 421 ccaaagagac actgacattc gtttttgaat acatgcacac agacctggcc cagtatatgt 481 ctcagcatcc aggagggctt catcctcata atgtcagact tttcatgttt caacttttgc 541 ggggcctggc gtacatccac caccaacacg ttcttcacag ggacctgaaa cctcagaact 601 tactcatcag tcacctggga gagctcaaac tggctgattt tggtcttgcc cgggccaagt 661 ccattcccag ccagacatac tcttcagaag tcgtgaccct ctggtaccgg ccccctgatg 721 ctttgctggg agccactgaa tattccTCTG AGCTGGACAT ATGGGGTGCA GGCTGCATCT 781 TTATTGAAAT GTTCCAGGGT CAACCTTTGT TTCCTGGGGT TTCCAACATC CTTGAACAGC 841 TGGAGAAAAT CTGGGAGGTG CTGGGAGTCC CTACAGAGGA TACTTGGCCG GGAGTCTCCA 901 AGCTACCTAA CTACAATCCA GAATGGTTCC CACTGCCTAC GCCTCGAAGC CTTCATGTTG 961 TCTGGAACAG GCTGGGCAGG GTTCCTGAAG CTGAAGACCT GGCCTCCCAG ATGCTAAAAG 1021 GCTTTCCCAG AGACCGCGTC TCCGCCCAGG AAGCACTTGT TCATGATTAT TTCAGCGCCC 1081 TGCCATCTCA GCTGTACCAG CTTCCTGATG AGTGCCCAAC TTTCTTGTAC AAAGTGGTTG 1141 ATATCGGTAA GCCTATCCCT AACCCTCTCC TCGGTCTCGA TTCTACGTAG TAATGAACTA 1201 GTCCGTAACT TGAAAGTATT TCGATTTCTT GGCTTTATAT ATCTTGTGGA AAGGACGAAG 1261 CAATTCTAAG CAATCTCCAA CGACGCGTTA AGTCgacaat caacctctgg attacaaaat 1321 ttgtgaaaga tt