Transcript: Mouse XM_011238543.1

PREDICTED: Mus musculus unc-80, NALCN activator (Unc80), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Unc80 (329178)
Length:
13707
CDS:
148..10158

Additional Resources:

NCBI RefSeq record:
XM_011238543.1
NBCI Gene record:
Unc80 (329178)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011238543.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000376136 GTACGTCGCACAGGAATTATT pLKO_005 5774 CDS 100% 15.000 21.000 N Unc80 n/a
2 TRCN0000376262 TTTACATTAGGTGGCTATATA pLKO_005 10565 3UTR 100% 15.000 21.000 N Unc80 n/a
3 TRCN0000189790 GCTCTCCAATCAACAGTCAGA pLKO.1 881 CDS 100% 2.640 3.696 N Unc80 n/a
4 TRCN0000341367 AGACCTATGTTCGAGACATTT pLKO_005 6545 CDS 100% 13.200 9.240 N Unc80 n/a
5 TRCN0000341307 TAATATTACTGCCCTCATAAT pLKO_005 10457 3UTR 100% 13.200 9.240 N Unc80 n/a
6 TRCN0000341306 ACTAGATGAGTCCCACGTTTA pLKO_005 10137 CDS 100% 10.800 7.560 N Unc80 n/a
7 TRCN0000376135 CAATAGACAAGATGAGCTAAT pLKO_005 6081 CDS 100% 10.800 7.560 N Unc80 n/a
8 TRCN0000341308 CACCAGCCAGGCAGCATATTT pLKO_005 8748 CDS 100% 15.000 9.000 N Unc80 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011238543.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.