Transcript: Mouse XM_011238719.2

PREDICTED: Mus musculus phosphotyrosine interaction domain containing 1 (Pid1), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pid1 (98496)
Length:
2446
CDS:
34..711

Additional Resources:

NCBI RefSeq record:
XM_011238719.2
NBCI Gene record:
Pid1 (98496)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011238719.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000268013 GGCAGTTAATTCGCAGTTAAA pLKO_005 1291 3UTR 100% 13.200 18.480 N Pid1 n/a
2 TRCN0000268011 GGGTGTACAGAGAGATCAATG pLKO_005 503 CDS 100% 10.800 8.640 N Pid1 n/a
3 TRCN0000183547 GCCTTAAATGAGAGCTAATAT pLKO.1 2067 3UTR 100% 15.000 10.500 N Pid1 n/a
4 TRCN0000268010 ATGATGGCTGAAGGAACTTAA pLKO_005 701 CDS 100% 13.200 9.240 N Pid1 n/a
5 TRCN0000283575 GATGAAGGCAAGGACTCATAG pLKO_005 138 CDS 100% 10.800 7.560 N Pid1 n/a
6 TRCN0000268012 CGCCATGATGGAGGCATTCAA pLKO_005 597 CDS 100% 5.625 3.938 N Pid1 n/a
7 TRCN0000430372 AGACTTTCCACAGTATGAAGA pLKO_005 620 CDS 100% 4.950 3.465 N PID1 n/a
8 TRCN0000184412 GCTTCATCACCTTGACCACAA pLKO.1 390 CDS 100% 4.050 2.835 N Pid1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011238719.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12138 pDONR223 100% 65.9% 68.8% None (many diffs) n/a
2 ccsbBroad304_12138 pLX_304 0% 65.9% 68.8% V5 (many diffs) n/a
3 TRCN0000470693 CGTTCTCCTTCAAAATTTGTACAG pLX_317 66.6% 65.9% 68.8% V5 (many diffs) n/a
Download CSV