Transcript: Mouse XM_011238925.1

PREDICTED: Mus musculus denticleless E3 ubiquitin protein ligase (Dtl), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dtl (76843)
Length:
4181
CDS:
610..2304

Additional Resources:

NCBI RefSeq record:
XM_011238925.1
NBCI Gene record:
Dtl (76843)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011238925.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243404 GCACCAGCTGTCTAGTATATT pLKO_005 3125 3UTR 100% 15.000 21.000 N Dtl n/a
2 TRCN0000194041 GTCTGGAGAGTGTGAAACAAA pLKO.1 1787 CDS 100% 5.625 4.500 N Dtl n/a
3 TRCN0000243407 ACTCCGAGGGTCCTACCAAAT pLKO_005 1913 CDS 100% 10.800 7.560 N Dtl n/a
4 TRCN0000174398 CGCAAGAATTACACTGCTTAT pLKO.1 850 CDS 100% 10.800 7.560 N Dtl n/a
5 TRCN0000243405 TGATGAAGCTGCCTACATTTG pLKO_005 1125 CDS 100% 10.800 7.560 N Dtl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011238925.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08305 pDONR223 100% 68.2% 69.1% None (many diffs) n/a
2 ccsbBroad304_08305 pLX_304 0% 68.2% 69.1% V5 (many diffs) n/a
3 TRCN0000468134 CGGGTGGCTTCCCGTGTACTAGGC pLX_317 15.3% 68.2% 69.1% V5 (many diffs) n/a
4 ccsbBroadEn_08304 pDONR223 100% 68.2% 69.1% None (many diffs) n/a
5 ccsbBroad304_08304 pLX_304 0% 68.2% 69.1% V5 (many diffs) n/a
6 TRCN0000479477 CTCAAAAGTCGCGCGGGCAAACGG pLX_317 15.3% 68.2% 69.1% V5 (many diffs) n/a
Download CSV