Transcript: Mouse XM_011239052.2

PREDICTED: Mus musculus TNF receptor-associated factor 1 (Traf1), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Traf1 (22029)
Length:
3037
CDS:
1197..2426

Additional Resources:

NCBI RefSeq record:
XM_011239052.2
NBCI Gene record:
Traf1 (22029)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011239052.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000364215 GGATCGGATCTGTCCTAAATG pLKO_005 1328 CDS 100% 13.200 18.480 N Traf1 n/a
2 TRCN0000364217 ACAACCGAGAGCATGCTATTG pLKO_005 2233 CDS 100% 10.800 7.560 N Traf1 n/a
3 TRCN0000364216 GCATCCTTTGATGGTACTTTC pLKO_005 1962 CDS 100% 10.800 7.560 N Traf1 n/a
4 TRCN0000067648 CCAGCCTAGATCAGGATGAAA pLKO.1 2704 3UTR 100% 5.625 3.938 N Traf1 n/a
5 TRCN0000067652 GCTGCGTGTGTTTGCAAACAT pLKO.1 1754 CDS 100% 5.625 3.938 N Traf1 n/a
6 TRCN0000067651 GCTTTCTACACTGCCAAGTAT pLKO.1 2058 CDS 100% 5.625 3.938 N Traf1 n/a
7 TRCN0000067650 CCTACGTCAAAGATGACACAA pLKO.1 2371 CDS 100% 4.950 3.465 N Traf1 n/a
8 TRCN0000067649 GCGGTCTTAAAGGAGTGGAAA pLKO.1 1536 CDS 100% 4.950 3.465 N Traf1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011239052.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07097 pDONR223 100% 84.2% 84.3% None (many diffs) n/a
2 ccsbBroad304_07097 pLX_304 0% 84.2% 84.3% V5 (many diffs) n/a
3 TRCN0000474794 TAGATGCTTGAATGCCCGGACTTC pLX_317 25.8% 84.2% 84.3% V5 (many diffs) n/a
Download CSV