Transcript: Mouse XM_011239089.2

PREDICTED: Mus musculus glycosyltransferase-like domain containing 1 (Gtdc1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gtdc1 (227835)
Length:
2541
CDS:
165..1502

Additional Resources:

NCBI RefSeq record:
XM_011239089.2
NBCI Gene record:
Gtdc1 (227835)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011239089.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418453 ACAGATTCCTAGAGACGTTAT pLKO_005 1713 3UTR 100% 10.800 15.120 N Gtdc1 n/a
2 TRCN0000435965 GACAACCCATCAGTCCATAAA pLKO_005 870 CDS 100% 13.200 10.560 N Gtdc1 n/a
3 TRCN0000189485 CACCGGAGAACTGTGAATCAA pLKO.1 805 CDS 100% 5.625 4.500 N Gtdc1 n/a
4 TRCN0000432298 ACCCAAGTGTCAAGTTATTTA pLKO_005 635 CDS 100% 15.000 10.500 N Gtdc1 n/a
5 TRCN0000433489 AGCACGCACAGCAGCCTTATA pLKO_005 287 CDS 100% 13.200 9.240 N Gtdc1 n/a
6 TRCN0000191141 CCAGAGACGTTCTTAAAGATA pLKO.1 1017 CDS 100% 5.625 3.938 N Gtdc1 n/a
7 TRCN0000192259 CCTAAGGATCTGGAAAGCATT pLKO.1 609 CDS 100% 4.950 3.465 N Gtdc1 n/a
8 TRCN0000192951 GCTGAGTATCTGTATTCCACA pLKO.1 1326 CDS 100% 2.640 1.848 N Gtdc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011239089.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.