Transcript: Mouse XM_011239178.1

PREDICTED: Mus musculus kynureninase (L-kynurenine hydrolase) (Kynu), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Kynu (70789)
Length:
2007
CDS:
163..1488

Additional Resources:

NCBI RefSeq record:
XM_011239178.1
NBCI Gene record:
Kynu (70789)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011239178.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000184752 CCCTACAATGAATGCGGGTTA pLKO.1 1758 3UTR 100% 4.050 5.670 N Kynu n/a
2 TRCN0000246658 GGGCCAATGGATTCCGAATTT pLKO_005 1067 CDS 100% 13.200 10.560 N Kynu n/a
3 TRCN0000246654 TGCTCCTTGCACGCCAGTTTA pLKO_005 1111 CDS 100% 13.200 10.560 N Kynu n/a
4 TRCN0000195774 CCTAGCACATGCAGTTGGAAA pLKO.1 843 CDS 100% 4.950 3.960 N Kynu n/a
5 TRCN0000215861 CAGAAAGAAGCTAGCTATATT pLKO.1 1475 CDS 100% 15.000 10.500 N Kynu n/a
6 TRCN0000246655 GGATGATGATGCCATCTATTT pLKO_005 357 CDS 100% 13.200 9.240 N Kynu n/a
7 TRCN0000246657 ATGACCTCAGTACAAGGTTTA pLKO_005 1016 CDS 100% 10.800 7.560 N Kynu n/a
8 TRCN0000051369 CCTCTCTATAATTCTTTCCAT pLKO.1 1408 CDS 100% 3.000 2.100 N KYNU n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011239178.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02052 pDONR223 100% 52.2% 50.7% None (many diffs) n/a
2 ccsbBroad304_02052 pLX_304 0% 52.2% 50.7% V5 (many diffs) n/a
3 TRCN0000472118 GGGCGCATCCCAGTACGAATTCCG pLX_317 45.9% 52.2% 50.7% V5 (many diffs) n/a
Download CSV