Transcript: Mouse XM_011239308.1

PREDICTED: Mus musculus integrin alpha 6 (Itga6), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Itga6 (16403)
Length:
5783
CDS:
180..3455

Additional Resources:

NCBI RefSeq record:
XM_011239308.1
NBCI Gene record:
Itga6 (16403)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011239308.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000066150 CGGCACAGCAACCTTGAATAT pLKO.1 2717 CDS 100% 13.200 18.480 N Itga6 n/a
2 TRCN0000066151 CCAGGGACTTACAACTGGAAA pLKO.1 801 CDS 100% 4.950 3.960 N Itga6 n/a
3 TRCN0000066149 CCTCAAGGTTAAAGCCTGTTT pLKO.1 1667 CDS 100% 4.950 3.465 N Itga6 n/a
4 TRCN0000057774 CGAGAAGGAAATCAAGACAAA pLKO.1 2112 CDS 100% 4.950 3.465 N ITGA6 n/a
5 TRCN0000289039 CGAGAAGGAAATCAAGACAAA pLKO_005 2112 CDS 100% 4.950 3.465 N ITGA6 n/a
6 TRCN0000066152 CGGAAATCCTTTCAAGAGAAA pLKO.1 2396 CDS 100% 4.950 3.465 N Itga6 n/a
7 TRCN0000296111 GACAACGTGATCCGGAAATAT pLKO_005 270 CDS 100% 15.000 21.000 N ITGA6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011239308.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06457 pDONR223 100% 84.4% 89.4% None (many diffs) n/a
2 TRCN0000479977 TGGTCTTCCTACACCCCTGGCGGG pLX_317 10.8% 84.4% 89.4% V5 (many diffs) n/a
Download CSV