Transcript: Mouse XM_011239325.2

PREDICTED: Mus musculus RNA binding motif protein 39 (Rbm39), transcript variant X10, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rbm39 (170791)
Length:
4014
CDS:
2051..3172

Additional Resources:

NCBI RefSeq record:
XM_011239325.2
NBCI Gene record:
Rbm39 (170791)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011239325.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294710 ATGTAGGCTCATTACACTTTA pLKO_005 2337 CDS 100% 13.200 18.480 N Rbm39 n/a
2 TRCN0000307379 TAACTAGCAAATCCTACTTTA pLKO_005 3344 3UTR 100% 13.200 10.560 N Rbm39 n/a
3 TRCN0000294706 GATTGCCTCATAGCATCAAAT pLKO_005 1917 5UTR 100% 13.200 9.240 N Rbm39 n/a
4 TRCN0000232613 GCTTCGAGTGCTAGTTCATTT pLKO_005 2573 CDS 100% 13.200 9.240 N RBM39 n/a
5 TRCN0000306959 GCTTCGAGTGCTAGTTCATTT pLKO_005 2573 CDS 100% 13.200 9.240 N Rbm39 n/a
6 TRCN0000109156 CCGCACAACAAGCATTACAAA pLKO.1 2700 CDS 100% 5.625 3.938 N Rbm39 n/a
7 TRCN0000109157 CCGAGAGATTTGGAAGAGTTT pLKO.1 2075 CDS 100% 4.950 3.465 N Rbm39 n/a
8 TRCN0000109158 CGAACTAGAAAGGACTGGAAT pLKO.1 2605 CDS 100% 4.950 3.465 N Rbm39 n/a
9 TRCN0000109159 GCTGCGTCTGTTCAACCTCTT pLKO.1 2822 CDS 100% 4.050 2.835 N Rbm39 n/a
10 TRCN0000287202 GCTGCGTCTGTTCAACCTCTT pLKO_005 2822 CDS 100% 4.050 2.835 N Rbm39 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011239325.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15672 pDONR223 0% 68.7% 73.4% None (many diffs) n/a
2 ccsbBroad304_15672 pLX_304 0% 68.7% 73.4% V5 (many diffs) n/a
Download CSV