Transcript: Mouse XM_011239400.2

PREDICTED: Mus musculus gamma-glutamyltransferase 7 (Ggt7), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ggt7 (207182)
Length:
2636
CDS:
62..2062

Additional Resources:

NCBI RefSeq record:
XM_011239400.2
NBCI Gene record:
Ggt7 (207182)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011239400.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000032424 CCCTGTCTATGATTCTACCAT pLKO.1 1345 CDS 100% 3.000 4.200 N Ggt7 n/a
2 TRCN0000032427 CCTACTCACCAGTGGACTATA pLKO.1 105 CDS 100% 13.200 9.240 N Ggt7 n/a
3 TRCN0000375675 CGTGATGTTGGTACATGATAT pLKO_005 625 CDS 100% 13.200 9.240 N Ggt7 n/a
4 TRCN0000366850 GGAATGAGAGCCACCTAATTG pLKO_005 651 CDS 100% 13.200 9.240 N Ggt7 n/a
5 TRCN0000376810 TCGCTGAGGTACTGGATATAC pLKO_005 1002 CDS 100% 13.200 9.240 N Ggt7 n/a
6 TRCN0000366851 GACCGCTTCCTGGATACTTTC pLKO_005 929 CDS 100% 10.800 7.560 N Ggt7 n/a
7 TRCN0000375676 GGAGGACTTCAGCAACTATAG pLKO_005 1117 CDS 100% 10.800 7.560 N Ggt7 n/a
8 TRCN0000432029 CTTAGGGATGTGCTTGCAAAC pLKO_005 2336 3UTR 100% 6.000 4.200 N GGT7 n/a
9 TRCN0000032425 CGTGGAGAAGGTAGATGTCTT pLKO.1 1948 CDS 100% 4.950 3.465 N Ggt7 n/a
10 TRCN0000032428 CCCGGAATGGTGAAAGGGTTA pLKO.1 770 CDS 100% 4.050 2.835 N Ggt7 n/a
11 TRCN0000032426 CCATGATCTAGCTCATGCCTT pLKO.1 880 CDS 100% 0.264 0.185 N Ggt7 n/a
12 TRCN0000375725 GGACCTTGAGGAGTCAGATTG pLKO_005 2277 3UTR 100% 10.800 6.480 N Ggt7 n/a
13 TRCN0000418129 GAGACCCTGAAGATTGCATTA pLKO_005 1301 CDS 100% 10.800 7.560 N GGT7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011239400.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06271 pDONR223 100% 89.2% 95.1% None (many diffs) n/a
2 ccsbBroad304_06271 pLX_304 0% 89.2% 95.1% V5 (many diffs) n/a
3 TRCN0000478008 CCGTACTCACTGTCGTTAAACCCA pLX_317 11.8% 89.2% 95.1% V5 (many diffs) n/a
Download CSV