Transcript: Mouse XM_011239415.2

PREDICTED: Mus musculus TRAF family member-associated Nf-kappa B activator (Tank), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tank (21353)
Length:
3091
CDS:
1669..2514

Additional Resources:

NCBI RefSeq record:
XM_011239415.2
NBCI Gene record:
Tank (21353)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011239415.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000054844 CGGCATCTTAATACACACTTT pLKO.1 2479 CDS 100% 4.950 6.930 N Tank n/a
2 TRCN0000301535 CGGCATCTTAATACACACTTT pLKO_005 2479 CDS 100% 4.950 6.930 N Tank n/a
3 TRCN0000054843 CGTACAGAGAATAACAGACAA pLKO.1 2891 3UTR 100% 4.950 3.960 N Tank n/a
4 TRCN0000301463 CGTACAGAGAATAACAGACAA pLKO_005 2891 3UTR 100% 4.950 3.960 N Tank n/a
5 TRCN0000054845 CCCAGGCTAAAGATGATATAA pLKO.1 1853 CDS 100% 15.000 10.500 N Tank n/a
6 TRCN0000301537 CCCAGGCTAAAGATGATATAA pLKO_005 1853 CDS 100% 15.000 10.500 N Tank n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011239415.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07531 pDONR223 100% 58.8% 55.5% None (many diffs) n/a
2 ccsbBroad304_07531 pLX_304 0% 58.8% 55.5% V5 (many diffs) n/a
3 TRCN0000481327 TCACTCCACTAATATAAGTACCTC pLX_317 22.2% 58.8% 55.5% V5 (many diffs) n/a
Download CSV