Transcript: Mouse XM_011239494.2

PREDICTED: Mus musculus PDX1 C-terminal inhibiting factor 1 (Pcif1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pcif1 (228866)
Length:
2658
CDS:
278..2398

Additional Resources:

NCBI RefSeq record:
XM_011239494.2
NBCI Gene record:
Pcif1 (228866)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011239494.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000111782 CGCCGATATCAGATGATGTTT pLKO.1 1691 CDS 100% 5.625 7.875 N Pcif1 n/a
2 TRCN0000111783 CATCCATGTTTCGTGAAATTA pLKO.1 1056 CDS 100% 15.000 10.500 N Pcif1 n/a
3 TRCN0000111781 CCATCCATGTTTCGTGAAATT pLKO.1 1055 CDS 100% 13.200 9.240 N Pcif1 n/a
4 TRCN0000111784 CCTGACACAGATGGCTACTTT pLKO.1 1856 CDS 100% 5.625 3.938 N Pcif1 n/a
5 TRCN0000158063 CATCCAGACCAATGCTGTCAT pLKO.1 811 CDS 100% 4.950 3.465 N PCIF1 n/a
6 TRCN0000285500 CATCCAGACCAATGCTGTCAT pLKO_005 811 CDS 100% 4.950 3.465 N PCIF1 n/a
7 TRCN0000156935 GTCCCTACTACTTCAACCGAT pLKO.1 453 CDS 100% 2.640 1.848 N PCIF1 n/a
8 TRCN0000111780 GCCAGGGACATAGGAATATTA pLKO.1 2496 3UTR 100% 15.000 9.000 N Pcif1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011239494.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.