Transcript: Mouse XM_011239559.2

PREDICTED: Mus musculus dual specificity phosphatase-like 15 (Dusp15), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dusp15 (252864)
Length:
3803
CDS:
924..1619

Additional Resources:

NCBI RefSeq record:
XM_011239559.2
NBCI Gene record:
Dusp15 (252864)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011239559.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000080864 CCGGAATAAGATCACACATAT pLKO.1 970 CDS 100% 13.200 9.240 N Dusp15 n/a
2 TRCN0000080866 TCAAAGAATGCGTCCACTTTA pLKO.1 1089 CDS 100% 13.200 9.240 N Dusp15 n/a
3 TRCN0000080867 CTTCAAAGAATGCGTCCACTT pLKO.1 1087 CDS 100% 4.050 2.835 N Dusp15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011239559.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09517 pDONR223 100% 79.8% 59.8% None (many diffs) n/a
2 ccsbBroad304_09517 pLX_304 0% 79.8% 59.8% V5 (many diffs) n/a
3 TRCN0000474112 CCTAAATTACCACCGGAGCAATCA pLX_317 69.6% 79.8% 59.8% V5 (many diffs) n/a
Download CSV